Transcript: Mouse NM_177389.3

Mus musculus melanoma inhibitory activity 3 (Mia3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mia3 (338366)
Length:
6933
CDS:
37..5829

Additional Resources:

NCBI RefSeq record:
NM_177389.3
NBCI Gene record:
Mia3 (338366)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177389.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089166 GCAGTCTTCGTTGGACACTTT pLKO.1 714 CDS 100% 4.950 6.930 N Mia3 n/a
2 TRCN0000089165 GCCTATCATAAACAGCTTCTT pLKO.1 2745 CDS 100% 4.950 6.930 N Mia3 n/a
3 TRCN0000089164 CCCTTAATCTTAACACTGAAA pLKO.1 2273 CDS 100% 4.950 3.465 N Mia3 n/a
4 TRCN0000089167 GCGAATGAGAAGACAGGGTTT pLKO.1 1978 CDS 100% 4.050 2.835 N Mia3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177389.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.