Transcript: Mouse NM_177582.3

Mus musculus MLX interacting protein (Mlxip), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mlxip (208104)
Length:
2649
CDS:
133..1977

Additional Resources:

NCBI RefSeq record:
NM_177582.3
NBCI Gene record:
Mlxip (208104)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177582.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306197 GACATGCTGTATTGGCATAAA pLKO_005 877 CDS 100% 13.200 18.480 N Mlxip n/a
2 TRCN0000306199 TGGCCCAACCCACGAGAAATA pLKO_005 1021 CDS 100% 13.200 18.480 N Mlxip n/a
3 TRCN0000124921 CCCTGTCTTTACGATGACCTT pLKO.1 1419 CDS 100% 2.640 3.696 N Mlxip n/a
4 TRCN0000326358 CCCTGTCTTTACGATGACCTT pLKO_005 1419 CDS 100% 2.640 3.696 N Mlxip n/a
5 TRCN0000311485 CAACAAAGCAATATGGATAAT pLKO_005 1981 3UTR 100% 13.200 9.240 N Mlxip n/a
6 TRCN0000306249 CATCTGGAGGGCATGGTATAT pLKO_005 627 CDS 100% 13.200 9.240 N Mlxip n/a
7 TRCN0000124919 CCCAGTTAAAGAAACAGTTAA pLKO.1 2390 3UTR 100% 13.200 9.240 N Mlxip n/a
8 TRCN0000124923 CCAACTGCATTGCCCTTAGTT pLKO.1 1471 CDS 100% 5.625 3.938 N Mlxip n/a
9 TRCN0000124920 CCTGTCTTTACGATGACCTTA pLKO.1 1420 CDS 100% 4.950 3.465 N Mlxip n/a
10 TRCN0000124922 CCTTTCTCTAAGGCTTTACAT pLKO.1 1932 CDS 100% 5.625 3.375 N Mlxip n/a
11 TRCN0000419605 GAAATAGCACATCTGGGAAAT pLKO_005 1036 CDS 100% 10.800 7.560 N MLXIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177582.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.