Transcript: Mouse NM_177620.4

Mus musculus Ras and Rab interactor 3 (Rin3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rin3 (217835)
Length:
3880
CDS:
213..3155

Additional Resources:

NCBI RefSeq record:
NM_177620.4
NBCI Gene record:
Rin3 (217835)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177620.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077650 CGACCGCAAACTGTATAAGAA pLKO.1 1994 CDS 100% 5.625 7.875 N Rin3 n/a
2 TRCN0000077651 ACGCAAATTGTTCCTGTGAAA pLKO.1 847 CDS 100% 4.950 6.930 N Rin3 n/a
3 TRCN0000077649 CGCAAATTGTTCCTGTGAAAT pLKO.1 848 CDS 100% 13.200 9.240 N Rin3 n/a
4 TRCN0000077648 CCAAGTTCTTAGTTGGATGTA pLKO.1 3327 3UTR 100% 4.950 3.465 N Rin3 n/a
5 TRCN0000077652 CCTGTGGTTTGTGAATCCTAT pLKO.1 893 CDS 100% 4.950 3.465 N Rin3 n/a
6 TRCN0000077865 GCCTGTGGTTTGTGAATCCTA pLKO.1 892 CDS 100% 3.000 2.100 N RIN3 n/a
7 TRCN0000363733 GCCTGTGGTTTGTGAATCCTA pLKO_005 892 CDS 100% 3.000 2.100 N RIN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177620.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.