Transcript: Mouse NM_177653.3

Mus musculus RIKEN cDNA F830045P16 gene (F830045P16Rik), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
F830045P16Rik (228592)
Length:
1925
CDS:
141..1604

Additional Resources:

NCBI RefSeq record:
NM_177653.3
NBCI Gene record:
F830045P16Rik (228592)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177653.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112344 GCAAGATATCTCGTCTCAGAT pLKO.1 452 CDS 100% 4.950 6.930 N F830045P16Rik n/a
2 TRCN0000112340 GCGATATTTCAGACTCAAGAT pLKO.1 1735 3UTR 100% 4.950 6.930 N F830045P16Rik n/a
3 TRCN0000436111 GAACCTGACTTGCCATGTAAA pLKO_005 611 CDS 100% 13.200 10.560 N F830045P16Rik n/a
4 TRCN0000444917 CATCCAGGCCAGCATTGTATT pLKO_005 1433 CDS 100% 13.200 9.240 N F830045P16Rik n/a
5 TRCN0000425109 GGTAGATGCCATATTGAATAA pLKO_005 755 CDS 100% 13.200 9.240 N F830045P16Rik n/a
6 TRCN0000438135 ATGGACCTCATCTGGACTAAG pLKO_005 651 CDS 100% 10.800 7.560 N F830045P16Rik n/a
7 TRCN0000112342 GCCTAAGTTCAGAGAAATCTA pLKO.1 1492 CDS 100% 5.625 3.938 N F830045P16Rik n/a
8 TRCN0000112343 CCAGAAACTCTGATGGGACTT pLKO.1 712 CDS 100% 4.050 2.835 N F830045P16Rik n/a
9 TRCN0000112341 GCCTCCAGTTAAGAACAGCAT pLKO.1 812 CDS 100% 2.640 1.848 N F830045P16Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177653.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.