Transcript: Mouse NM_177656.4

Mus musculus RIKEN cDNA 6820408C15 gene (6820408C15Rik), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
6820408C15Rik (228778)
Length:
1701
CDS:
423..1487

Additional Resources:

NCBI RefSeq record:
NM_177656.4
NBCI Gene record:
6820408C15Rik (228778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191068 CAGAGAGCTTATTGAACAGAT pLKO.1 1301 CDS 100% 4.950 3.465 N 6820408C15Rik n/a
2 TRCN0000191403 CCAACGTAATTCAAGAGAAGA pLKO.1 1171 CDS 100% 4.950 3.465 N 6820408C15Rik n/a
3 TRCN0000202409 GACTTCGAAGAAGGGACCAAA pLKO.1 640 CDS 100% 4.950 3.465 N 6820408C15Rik n/a
4 TRCN0000190042 GAGAGCAAGACAAACAGCCTT pLKO.1 945 CDS 100% 2.640 1.848 N 6820408C15Rik n/a
5 TRCN0000202251 GAAGGAGGAGAGCAAGACAAA pLKO.1 938 CDS 100% 4.950 2.970 N 6820408C15Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.