Transcript: Mouse NM_177663.4

Mus musculus interferon stimulated exonuclease gene 20-like 2 (Isg20l2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Isg20l2 (229504)
Length:
2893
CDS:
452..1558

Additional Resources:

NCBI RefSeq record:
NM_177663.4
NBCI Gene record:
Isg20l2 (229504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120730 CAAACATCAACGCTTTGTCAA pLKO.1 517 CDS 100% 4.950 3.960 N Isg20l2 n/a
2 TRCN0000120728 CCAAGCTCGTTCTGAAGATAA pLKO.1 976 CDS 100% 13.200 9.240 N Isg20l2 n/a
3 TRCN0000120729 CCCTAACAAGGTGTCTAAGTT pLKO.1 589 CDS 100% 5.625 3.938 N Isg20l2 n/a
4 TRCN0000120731 CGGAGTCAGATCTTGAAGATA pLKO.1 1235 CDS 100% 5.625 3.938 N Isg20l2 n/a
5 TRCN0000120727 GCTCAGCATAATGGTCTGTAA pLKO.1 2521 3UTR 100% 4.950 2.970 N Isg20l2 n/a
6 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 2361 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.