Transcript: Mouse NM_177668.2

Mus musculus selection and upkeep of intraepithelial T cells 10 (Skint10), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Skint10 (230613)
Length:
1729
CDS:
41..1105

Additional Resources:

NCBI RefSeq record:
NM_177668.2
NBCI Gene record:
Skint10 (230613)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258072 AGCGTTGTCCTACCAGATATC pLKO_005 455 CDS 100% 10.800 15.120 N Skint10 n/a
2 TRCN0000250728 ATGATGTGAGCTGCGAAATAT pLKO_005 969 CDS 100% 15.000 10.500 N Skint10 n/a
3 TRCN0000250726 ATGGATGTCTTGAACTATAAA pLKO_005 1126 3UTR 100% 15.000 10.500 N Skint10 n/a
4 TRCN0000250729 CAGAGTTCAAAGTCCTATTAC pLKO_005 391 CDS 100% 13.200 9.240 N Skint10 n/a
5 TRCN0000250727 TTGGATGATGCATACCCATTA pLKO_005 755 CDS 100% 10.800 7.560 N Skint10 n/a
6 TRCN0000182942 CAAGCTATGAGCTTGGATATA pLKO.1 185 CDS 100% 1.320 0.924 N Skint10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.