Transcript: Mouse NM_177709.3

Mus musculus tumor suppressor candidate 5 (Tusc5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tusc5 (237858)
Length:
3237
CDS:
288..809

Additional Resources:

NCBI RefSeq record:
NM_177709.3
NBCI Gene record:
Tusc5 (237858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177709.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042473 CGTAGCGTAAACTGCCAGAAT pLKO.1 1091 3UTR 100% 4.950 6.930 N Tusc5 n/a
2 TRCN0000042476 CTGCCTGAGATGGAGAAACTA pLKO.1 345 CDS 100% 5.625 3.938 N Tusc5 n/a
3 TRCN0000042477 CCTGGGCATCGTTATCATCAT pLKO.1 752 CDS 100% 4.950 3.465 N Tusc5 n/a
4 TRCN0000042475 GCTACTCAGCATCACCTTCAT pLKO.1 728 CDS 100% 4.950 3.465 N Tusc5 n/a
5 TRCN0000042474 CCCAAAGATTACCTGGTCCTT pLKO.1 579 CDS 100% 2.640 1.848 N Tusc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177709.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.