Transcript: Mouse NM_177711.3

Mus musculus spermatogenesis associated 31 subfamily D, member 1D (Spata31d1d), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Spata31d1d (238663)
Length:
3827
CDS:
33..3776

Additional Resources:

NCBI RefSeq record:
NM_177711.3
NBCI Gene record:
Spata31d1d (238663)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267001 AGCTCTATTGCAATCGGAAAT pLKO_005 1535 CDS 100% 10.800 15.120 N Spata31d1d n/a
2 TRCN0000192710 GCAGTCTGTCAGATCAATCTT pLKO.1 2089 CDS 100% 5.625 4.500 N Spata31d1d n/a
3 TRCN0000266998 ACGAACAGACTCTAGAGATTA pLKO_005 1984 CDS 100% 13.200 9.240 N Spata31d1d n/a
4 TRCN0000266999 ATGGATGACAAACACGTATTT pLKO_005 2514 CDS 100% 13.200 9.240 N Spata31d1d n/a
5 TRCN0000267000 CCTGTCACTCTGTCCAGATTA pLKO_005 2208 CDS 100% 13.200 9.240 N Spata31d1d n/a
6 TRCN0000266997 GCCAGTGCAAGAGTGCTAAAG pLKO_005 2614 CDS 100% 10.800 7.560 N Spata31d1d n/a
7 TRCN0000217311 GCTCTATTGCAATCGGAAATC pLKO.1 1536 CDS 100% 10.800 7.560 N Spata31d1d n/a
8 TRCN0000202229 CCAGTGCAAGAGTGCTAAAGA pLKO.1 2615 CDS 100% 5.625 3.938 N Spata31d1d n/a
9 TRCN0000191356 CAAACACGTATTTGTATCCAA pLKO.1 2522 CDS 100% 3.000 2.100 N Spata31d1d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.