Transcript: Mouse NM_177725.4

Mus musculus leucine rich repeat containing 8A (Lrrc8a), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Lrrc8a (241296)
Length:
4254
CDS:
155..2587

Additional Resources:

NCBI RefSeq record:
NM_177725.4
NBCI Gene record:
Lrrc8a (241296)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177725.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130750 GCACAACATCAAGTTCGACGT pLKO.1 1012 CDS 100% 2.160 3.024 N LRRC8A n/a
2 TRCN0000250780 TAACTTAGATCTGGGTATTTA pLKO_005 2877 3UTR 100% 15.000 10.500 N Lrrc8a n/a
3 TRCN0000250779 ACAACCGCTACATCGTCATTG pLKO_005 1746 CDS 100% 10.800 7.560 N Lrrc8a n/a
4 TRCN0000250782 AGCCTCAAGAAGATGGTTAAC pLKO_005 1910 CDS 100% 10.800 7.560 N Lrrc8a n/a
5 TRCN0000250781 CCATCGTCATGCTGATGATTG pLKO_005 249 CDS 100% 10.800 7.560 N Lrrc8a n/a
6 TRCN0000258075 CTCTACACCTGGGCAACAATG pLKO_005 2358 CDS 100% 10.800 7.560 N Lrrc8a n/a
7 TRCN0000118626 CATCTGCTACACCGTCTACTA pLKO.1 988 CDS 100% 4.950 3.465 N LRRC8A n/a
8 TRCN0000118625 GCAGAAGCTGTCCATCAACAA pLKO.1 1861 CDS 100% 4.950 3.465 N LRRC8A n/a
9 TRCN0000127691 GCAGAAGCTGTCCATCAACAA pLKO.1 1861 CDS 100% 4.950 3.465 N LRRC8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177725.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.