Transcript: Mouse NM_177726.4

Mus musculus transglutaminase 6 (Tgm6), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Tgm6 (241636)
Length:
3327
CDS:
88..2208

Additional Resources:

NCBI RefSeq record:
NM_177726.4
NBCI Gene record:
Tgm6 (241636)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177726.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110671 GCCTTGATTCAATTCAACATA pLKO.1 2083 CDS 100% 5.625 4.500 N Tgm6 n/a
2 TRCN0000110674 CAATCTGAGTGTGGACAAATA pLKO.1 1005 CDS 100% 13.200 9.240 N Tgm6 n/a
3 TRCN0000110672 GCAATCTGAGTGTGGACAAAT pLKO.1 1004 CDS 100% 13.200 9.240 N Tgm6 n/a
4 TRCN0000110673 CAGTTTATTCTCCTGTTCAAT pLKO.1 478 CDS 100% 5.625 3.938 N Tgm6 n/a
5 TRCN0000110670 GCCATGAAGAATATGCCACTA pLKO.1 2965 3UTR 100% 4.050 2.835 N Tgm6 n/a
6 TRCN0000056297 CGAGGCGTGGAGAAGCACATA pLKO.1 583 CDS 100% 1.650 1.155 N TGM6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177726.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.