Transcript: Mouse NM_177750.6

Mus musculus FERM and PDZ domain containing 3 (Frmpd3), transcript variant 2, mRNA.

Source:
NCBI, updated 2016-06-24
Taxon:
Mus musculus (mouse)
Gene:
Frmpd3 (245643)
Length:
1401
CDS:
421..807

Additional Resources:

NCBI RefSeq record:
NM_177750.6
NBCI Gene record:
Frmpd3 (245643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177750.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197599 CACACTACCATGGAATGAAAT pLKO.1 671 CDS 100% 13.200 9.240 N Frmpd3 n/a
2 TRCN0000197427 CCAAGGTTTGACAAGTTCTTT pLKO.1 1030 3UTR 100% 5.625 3.938 N Frmpd3 n/a
3 TRCN0000176741 CCATCACAATGAAGTTACTAT pLKO.1 837 3UTR 100% 5.625 3.938 N Frmpd3 n/a
4 TRCN0000177986 GACCACTGTTAAGGATGTGAT pLKO.1 513 CDS 100% 4.950 3.465 N Frmpd3 n/a
5 TRCN0000177324 GACTTGAATTTGATGGTCAAA pLKO.1 925 3UTR 100% 4.950 3.465 N Frmpd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177750.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.