Transcript: Mouse NM_177773.4

Mus musculus RIKEN cDNA 4933408B17 gene (4933408B17Rik), mRNA.

Source:
NCBI, updated 2017-06-13
Taxon:
Mus musculus (mouse)
Gene:
4933408B17Rik (271508)
Length:
2362
CDS:
1193..2014

Additional Resources:

NCBI RefSeq record:
NM_177773.4
NBCI Gene record:
4933408B17Rik (271508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177773.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238291 ACGACTCTGATCATCACATAT pLKO_005 1896 CDS 100% 13.200 9.240 N 4933408B17Rik n/a
2 TRCN0000377068 TCTATTCCCTTTCCAAATAAG pLKO_005 2145 3UTR 100% 13.200 9.240 N 4933408B17Rik n/a
3 TRCN0000345712 CTAAGCCAAGGTGATCCTATT pLKO_005 1634 CDS 100% 10.800 7.560 N 4933408B17Rik n/a
4 TRCN0000353239 TCTTGTGGGTGACGTAGAAAG pLKO_005 1405 CDS 100% 10.800 7.560 N 4933408B17Rik n/a
5 TRCN0000238290 TGATTGCCAGTCACAGGTTTA pLKO_005 1701 CDS 100% 10.800 7.560 N 4933408B17Rik n/a
6 TRCN0000238289 ATGCCTTGCCTCCTAACTAAG pLKO_005 2173 3UTR 100% 10.800 6.480 N 4933408B17Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177773.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.