Transcript: Mouse NM_177793.3

Mus musculus methyltransferase like 24 (Mettl24), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mettl24 (327747)
Length:
1529
CDS:
75..1166

Additional Resources:

NCBI RefSeq record:
NM_177793.3
NBCI Gene record:
Mettl24 (327747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192328 CCTTGAGTTGGGTGAATACAA pLKO.1 1135 CDS 100% 5.625 7.875 N Mettl24 n/a
2 TRCN0000434834 TGCGATCACATGGGTACAGAC pLKO_005 489 CDS 100% 4.050 5.670 N Mettl24 n/a
3 TRCN0000422115 TGGATGTGAAGTGCATCGTTT pLKO_005 668 CDS 100% 4.950 3.960 N Mettl24 n/a
4 TRCN0000421253 ACGTACAGCACAGGTGGATAC pLKO_005 1182 3UTR 100% 6.000 4.200 N Mettl24 n/a
5 TRCN0000437937 GCTCGTCTTCGAGATTCATCT pLKO_005 941 CDS 100% 4.950 3.465 N Mettl24 n/a
6 TRCN0000201614 CTTGGGTGATTGTCTCCTGAA pLKO.1 1270 3UTR 100% 4.050 2.835 N Mettl24 n/a
7 TRCN0000201196 GAATGAATTTGGGCACCACAA pLKO.1 830 CDS 100% 4.050 2.835 N Mettl24 n/a
8 TRCN0000192712 GACTTAACGAAACCTCAGCTT pLKO.1 1074 CDS 100% 2.640 1.848 N Mettl24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.