Transcript: Mouse NM_177816.3

Mus musculus SH2 domain containing 4B (Sh2d4b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Sh2d4b (328381)
Length:
1296
CDS:
1..1296

Additional Resources:

NCBI RefSeq record:
NM_177816.3
NBCI Gene record:
Sh2d4b (328381)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177816.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248438 ATATGACCGAGGGAGCATTTC pLKO_005 1022 CDS 100% 10.800 7.560 N Sh2d4b n/a
2 TRCN0000201168 GCAAGACTTTATCACCAACTT pLKO.1 796 CDS 100% 4.950 3.465 N Sh2d4b n/a
3 TRCN0000248435 GGTCAAGAGAGCGAGCAACAA pLKO_005 174 CDS 100% 4.950 3.465 N Sh2d4b n/a
4 TRCN0000257549 TCCGGGTCAGTGAGAAGATCT pLKO_005 1046 CDS 100% 4.950 3.465 N Sh2d4b n/a
5 TRCN0000172698 GCAGAAGCACATCCTCTTCTA pLKO.1 66 CDS 100% 0.495 0.347 N SH2D4B n/a
6 TRCN0000248437 CCTTGGTTTCATGGAATTATT pLKO_005 970 CDS 100% 15.000 9.000 N Sh2d4b n/a
7 TRCN0000189943 GCCACCCTAACAGATCTCATT pLKO.1 1171 CDS 100% 4.950 2.970 N Sh2d4b n/a
8 TRCN0000248436 GCCACCCTAACAGATCTCATT pLKO_005 1171 CDS 100% 4.950 2.970 N Sh2d4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177816.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.