Transcript: Mouse NM_177832.3

Mus musculus zinc finger protein 236 (Zfp236), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zfp236 (329002)
Length:
9473
CDS:
38..5437

Additional Resources:

NCBI RefSeq record:
NM_177832.3
NBCI Gene record:
Zfp236 (329002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177832.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215877 CCATTAGGTGAACATTATATT pLKO.1 9040 3UTR 100% 15.000 21.000 N Zfp236 n/a
2 TRCN0000242178 TTGCTCTATCTGGGTTATTTA pLKO_005 7101 3UTR 100% 15.000 21.000 N Zfp236 n/a
3 TRCN0000242179 CATAACTGACCTAGGTCTTAT pLKO_005 1774 CDS 100% 13.200 18.480 N Zfp236 n/a
4 TRCN0000242181 ACGCCAACTGTTGCACATATT pLKO_005 3396 CDS 100% 13.200 10.560 N Zfp236 n/a
5 TRCN0000242180 TACTGTCATCGAGCATATAAA pLKO_005 1880 CDS 100% 15.000 10.500 N Zfp236 n/a
6 TRCN0000216826 GCCACGATCTTTCAGACTTTA pLKO.1 878 CDS 100% 13.200 9.240 N Zfp236 n/a
7 TRCN0000005507 GCTAACTTGGTTGGACCAAAT pLKO.1 3998 CDS 100% 10.800 7.560 N ZNF236 n/a
8 TRCN0000194441 GAAATAGCTTACCAGGTGACT pLKO.1 4796 CDS 100% 2.640 1.848 N Zfp236 n/a
9 TRCN0000194411 CTCACCACAAGTCATCTTAGT pLKO.1 4738 CDS 100% 4.950 2.970 N Zfp236 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177832.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.