Transcript: Mouse NM_177852.4

Mus musculus death inducer-obliterator 1 (Dido1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Dido1 (23856)
Length:
7259
CDS:
278..3829

Additional Resources:

NCBI RefSeq record:
NM_177852.4
NBCI Gene record:
Dido1 (23856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177852.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346606 TCGCCCACCCTATTGAGTAAA pLKO_005 1841 CDS 100% 13.200 18.480 N Dido1 n/a
2 TRCN0000346526 ATGGTGACTGTGTGGGTATTT pLKO_005 1146 CDS 100% 13.200 9.240 N Dido1 n/a
3 TRCN0000015094 GCCTCACAACAACAGGTTTAT pLKO.1 1093 CDS 100% 13.200 9.240 N DIDO1 n/a
4 TRCN0000346527 GGAGAAGACCAGGGCATAAAG pLKO_005 1349 CDS 100% 13.200 9.240 N Dido1 n/a
5 TRCN0000176151 GAAGACTACATCTGCCCAAAT pLKO.1 1202 CDS 100% 10.800 7.560 N Dido1 n/a
6 TRCN0000216517 GATTTCTAAGTTCAGGTAAAG pLKO.1 1548 CDS 100% 10.800 7.560 N Dido1 n/a
7 TRCN0000194338 CAGCCTCACAACAACAGGTTT pLKO.1 1091 CDS 100% 4.950 3.465 N Dido1 n/a
8 TRCN0000175810 GTATCTGACTCCTTAGGGAAA pLKO.1 647 CDS 100% 4.050 2.835 N Dido1 n/a
9 TRCN0000138947 GAGAGAGAGGAGAGAGAGAAA pLKO.1 5905 3UTR 100% 4.950 2.475 Y TVP23C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177852.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.