Transcript: Mouse NM_177880.4

Mus musculus speedy/RINGO cell cycle regulator family, member E4B (Spdye4b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Spdye4b (330228)
Length:
2158
CDS:
546..1256

Additional Resources:

NCBI RefSeq record:
NM_177880.4
NBCI Gene record:
Spdye4b (330228)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177880.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181696 CATGCCGTCTAAATCTGCTTT pLKO.1 578 CDS 100% 4.950 6.930 N Spdye4b n/a
2 TRCN0000200031 CCTAGAAGAACCCAGACTCTT pLKO.1 1328 3UTR 100% 4.950 2.475 Y Spdye4b n/a
3 TRCN0000198595 CCTGTCTATGGTCATAGCTTA pLKO.1 890 CDS 100% 4.950 2.475 Y Spdye4b n/a
4 TRCN0000177615 CATCTAAATGTTATCCCGAAT pLKO.1 1469 3UTR 100% 4.050 2.025 Y Spdye4b n/a
5 TRCN0000198579 GCAGAGCTATTTGAACCTGAT pLKO.1 693 CDS 100% 4.050 2.025 Y Spdye4b n/a
6 TRCN0000182645 GTGTGAAGAGATCCAGGCTTA pLKO.1 1130 CDS 100% 4.050 2.025 Y Spdye4b n/a
7 TRCN0000182838 CATGTTCCACAAACTGCGCTT pLKO.1 1061 CDS 100% 2.160 1.080 Y Spdye4b n/a
8 TRCN0000178718 CCATCTAAATGTTATCCCGAA pLKO.1 1468 3UTR 100% 2.160 1.080 Y Spdye4b n/a
9 TRCN0000189447 CAGACAAGTACCTCCTGTCTA pLKO.1 877 CDS 100% 0.495 0.248 Y Spdye4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177880.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.