Transcript: Mouse NM_177905.3

Mus musculus piwi-like RNA-mediated gene silencing 4 (Piwil4), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Piwil4 (330890)
Length:
2637
CDS:
1..2637

Additional Resources:

NCBI RefSeq record:
NM_177905.3
NBCI Gene record:
Piwil4 (330890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364224 CATATCGTATCGATGACATTG pLKO_005 1055 CDS 100% 10.800 15.120 N Piwil4 n/a
2 TRCN0000364222 CTCGTTGTCCTTACCAGATAC pLKO_005 1024 CDS 100% 10.800 15.120 N Piwil4 n/a
3 TRCN0000197570 CAACGTTATCTATGATGACAA pLKO.1 2433 CDS 100% 4.950 6.930 N Piwil4 n/a
4 TRCN0000141814 GTACCAAATTGGACGGAACTT pLKO.1 831 CDS 100% 0.000 0.000 N PIWIL4 n/a
5 TRCN0000176917 GCCTTTGAATAGATGGTTGAT pLKO.1 1650 CDS 100% 4.950 3.960 N Piwil4 n/a
6 TRCN0000368870 AGAGAACAGCGGCTGATATTG pLKO_005 2171 CDS 100% 13.200 9.240 N Piwil4 n/a
7 TRCN0000364223 AGCAATATGATATCACCTTAT pLKO_005 1151 CDS 100% 10.800 7.560 N Piwil4 n/a
8 TRCN0000197969 GCTGTTTGTAGTAACTATCTT pLKO.1 55 CDS 100% 5.625 3.938 N Piwil4 n/a
9 TRCN0000176520 CAGCAATATGATATCACCTTA pLKO.1 1150 CDS 100% 4.950 3.465 N Piwil4 n/a
10 TRCN0000198921 GCTCCTATTCAATGCTGACGT pLKO.1 894 CDS 100% 2.640 1.848 N Piwil4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.