Transcript: Human NM_177939.3

Homo sapiens prolyl 4-hydroxylase, transmembrane (P4HTM), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-19
Taxon:
Homo sapiens (human)
Gene:
P4HTM (54681)
Length:
1771
CDS:
17..1525

Additional Resources:

NCBI RefSeq record:
NM_177939.3
NBCI Gene record:
P4HTM (54681)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177939.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055486 CTGCCTACTGAAGAGTATGAA pLKO.1 536 CDS 100% 5.625 4.500 N P4HTM n/a
2 TRCN0000055484 CAAGTACATGAGGAGCCACAA pLKO.1 790 CDS 100% 4.050 2.835 N P4HTM n/a
3 TRCN0000055487 GAGTTCTCCAACATGGACCTT pLKO.1 758 CDS 100% 2.640 1.848 N P4HTM n/a
4 TRCN0000055485 CCCGGCTTCCTGACTGATGAA pLKO.1 458 CDS 100% 1.650 1.155 N P4HTM n/a
5 TRCN0000184137 CATACCAAGCTGGTAGCCAAT pLKO.1 1040 CDS 100% 4.050 2.835 N P4htm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177939.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.