Transcript: Mouse NM_178029.3

Mus musculus SET domain containing 1A (Setd1a), mRNA.

Source:
NCBI, updated 2019-04-15
Taxon:
Mus musculus (mouse)
Gene:
Setd1a (233904)
Length:
5934
CDS:
141..5291

Additional Resources:

NCBI RefSeq record:
NM_178029.3
NBCI Gene record:
Setd1a (233904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178029.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218922 TCTAGCTACCCAGCATATTAT pLKO_005 1230 CDS 100% 15.000 21.000 N Setd1a n/a
2 TRCN0000225920 CGGCGGTTACTAAGCGCTATT pLKO_005 4788 CDS 100% 10.800 15.120 N Setd1a n/a
3 TRCN0000225921 TGCCCAAACACCCTCTTAATT pLKO_005 5475 3UTR 100% 15.000 10.500 N Setd1a n/a
4 TRCN0000225919 ATCGAAAGATGGTCGAGAATG pLKO_005 2617 CDS 100% 10.800 7.560 N Setd1a n/a
5 TRCN0000413410 AGGAGGAAGATGAAGAGGAAG pLKO_005 4258 CDS 100% 4.050 2.025 Y Myt1 n/a
6 TRCN0000092881 GAGGAAGATGAAGAGGAGGAA pLKO.1 4260 CDS 100% 2.640 1.320 Y Gm4169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178029.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.