Transcript: Mouse NM_178086.3

Mus musculus fatty acid 2-hydroxylase (Fa2h), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fa2h (338521)
Length:
2492
CDS:
70..1188

Additional Resources:

NCBI RefSeq record:
NM_178086.3
NBCI Gene record:
Fa2h (338521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197833 GCCCTTTCTAATCCTATGTAT pLKO.1 2208 3UTR 100% 5.625 7.875 N Fa2h n/a
2 TRCN0000198815 CGCATCACTCACAAGAGAGTA pLKO.1 666 CDS 100% 4.950 6.930 N Fa2h n/a
3 TRCN0000178127 GCATCACTCACAAGAGAGTAT pLKO.1 667 CDS 100% 4.950 6.930 N Fa2h n/a
4 TRCN0000198161 CGAATACCAGAAATCAGGGTT pLKO.1 1092 CDS 100% 2.640 3.696 N Fa2h n/a
5 TRCN0000176521 CCTATGTATTGAGCTTATGTA pLKO.1 2220 3UTR 100% 5.625 3.938 N Fa2h n/a
6 TRCN0000178206 CAGCCATTACCTCATCATGTT pLKO.1 804 CDS 100% 4.950 3.465 N Fa2h n/a
7 TRCN0000176550 CATCACTTCGAATACCAGAAA pLKO.1 1084 CDS 100% 4.950 3.465 N Fa2h n/a
8 TRCN0000181282 CCCTAGTGATTGCCTTCTTCT pLKO.1 902 CDS 100% 4.950 3.465 N Fa2h n/a
9 TRCN0000181405 CTCCCTAGTGATTGCCTTCTT pLKO.1 900 CDS 100% 4.950 3.465 N Fa2h n/a
10 TRCN0000198399 GAGAAGTATGATGAGTGGGTT pLKO.1 484 CDS 100% 2.640 1.848 N Fa2h n/a
11 TRCN0000197600 CCAAGAAGAAACAGCATGATT pLKO.1 1677 3UTR 100% 5.625 3.938 N Fa2h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.