Transcript: Human NM_178160.3

Homo sapiens otopetrin 2 (OTOP2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
OTOP2 (92736)
Length:
2150
CDS:
95..1783

Additional Resources:

NCBI RefSeq record:
NM_178160.3
NBCI Gene record:
OTOP2 (92736)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178160.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443305 ACCGGCTACTACTCCAGTTTC pLKO_005 458 CDS 100% 10.800 15.120 N OTOP2 n/a
2 TRCN0000432410 ATATCCCTTCAACATCGAGTA pLKO_005 823 CDS 100% 4.050 5.670 N OTOP2 n/a
3 TRCN0000167225 CTTCCAGAACATGTTTATCAT pLKO.1 1339 CDS 100% 5.625 3.938 N OTOP2 n/a
4 TRCN0000168160 CTGTTTCTCCTACTCTGCAAT pLKO.1 1586 CDS 100% 4.950 3.465 N OTOP2 n/a
5 TRCN0000429181 GATGAATCTGTGCACCAATCC pLKO_005 662 CDS 100% 4.050 2.835 N OTOP2 n/a
6 TRCN0000168585 GCAATGTCATTCTGTGGATCA pLKO.1 1602 CDS 100% 4.050 2.835 N OTOP2 n/a
7 TRCN0000167905 CTGCAATGTCATTCTGTGGAT pLKO.1 1600 CDS 100% 2.640 1.848 N OTOP2 n/a
8 TRCN0000168726 GTTTGTCATCATCCAGACCTA pLKO.1 529 CDS 100% 2.640 1.848 N OTOP2 n/a
9 TRCN0000181712 GCTGTATGTCATGTGGAAGAA pLKO.1 865 CDS 100% 4.950 2.970 N Otop2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178160.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.