Transcript: Human NM_178233.2

Homo sapiens otopetrin 3 (OTOP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
OTOP3 (347741)
Length:
2367
CDS:
1..1791

Additional Resources:

NCBI RefSeq record:
NM_178233.2
NBCI Gene record:
OTOP3 (347741)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178233.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134200 CAATATCACACTGTGGATGAT pLKO.1 1611 CDS 100% 4.950 6.930 N OTOP3 n/a
2 TRCN0000137276 CCAGTACTTCACCCTCTACTA pLKO.1 1107 CDS 100% 4.950 3.465 N OTOP3 n/a
3 TRCN0000167933 CCTCTACTATGCCTTCTATGT pLKO.1 1119 CDS 100% 4.950 3.465 N OTOP3 n/a
4 TRCN0000137461 GCGTCTTTGTGCTCTTCCAAA pLKO.1 1058 CDS 100% 4.950 3.465 N OTOP3 n/a
5 TRCN0000135680 GCTGTTTGTCATGTGGAAGAA pLKO.1 921 CDS 100% 4.950 2.970 N OTOP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178233.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.