Transcript: Mouse NM_178254.3

Mus musculus transcription factor-like 5 (basic helix-loop-helix) (Tcfl5), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Tcfl5 (277353)
Length:
2237
CDS:
103..1572

Additional Resources:

NCBI RefSeq record:
NM_178254.3
NBCI Gene record:
Tcfl5 (277353)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085069 CGCAGAGTTCTAGTAACTCAT pLKO.1 896 CDS 100% 0.495 0.693 N Tcfl5 n/a
2 TRCN0000426724 GATGAAGACATCTTGATAATT pLKO_005 1774 3UTR 100% 15.000 10.500 N Tcfl5 n/a
3 TRCN0000418148 CAGTCTCATGGTACTCTATTG pLKO_005 2026 3UTR 100% 10.800 7.560 N Tcfl5 n/a
4 TRCN0000085068 CGACACCATCATGTGTTCTTA pLKO.1 1817 3UTR 100% 5.625 3.938 N Tcfl5 n/a
5 TRCN0000085071 CAAGAGATTGAGTCCACCAAA pLKO.1 985 CDS 100% 4.950 3.465 N Tcfl5 n/a
6 TRCN0000085070 CGGAGACAGATAAAGCAACAA pLKO.1 1364 CDS 100% 4.950 3.465 N Tcfl5 n/a
7 TRCN0000085072 GTTTGGATTAAAGTGGGAGAA pLKO.1 1045 CDS 100% 4.050 2.835 N Tcfl5 n/a
8 TRCN0000014610 CCGCATTTGCTGTGATGAGTT pLKO.1 1317 CDS 100% 4.950 3.465 N TCFL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.