Transcript: Mouse NM_178363.4

Mus musculus YLP motif containing 1 (Ylpm1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Ylpm1 (56531)
Length:
11052
CDS:
170..6589

Additional Resources:

NCBI RefSeq record:
NM_178363.4
NBCI Gene record:
Ylpm1 (56531)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178363.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312876 CCGAGATATGCCTACTAATAA pLKO_005 5089 CDS 100% 15.000 21.000 N Ylpm1 n/a
2 TRCN0000124906 GCCGAGATATGCCTACTAATA pLKO.1 5088 CDS 100% 13.200 18.480 N Ylpm1 n/a
3 TRCN0000124908 CGTCCAAGTAATATAACAGAT pLKO.1 5246 CDS 100% 4.950 6.930 N Ylpm1 n/a
4 TRCN0000311829 CGTCCAAGTAATATAACAGAT pLKO_005 5246 CDS 100% 4.950 6.930 N Ylpm1 n/a
5 TRCN0000374327 TCGTCCTCCTCACAATCATAT pLKO_005 800 CDS 100% 13.200 10.560 N Ylpm1 n/a
6 TRCN0000124907 CGGGATAAGGAAGTAGAATTT pLKO.1 5711 CDS 100% 13.200 9.240 N Ylpm1 n/a
7 TRCN0000311828 CGGGATAAGGAAGTAGAATTT pLKO_005 5711 CDS 100% 13.200 9.240 N Ylpm1 n/a
8 TRCN0000124904 GCTATATCCAAGCAAGACATT pLKO.1 6774 3UTR 100% 4.950 3.465 N Ylpm1 n/a
9 TRCN0000124905 GCCAAGAACAAGACTGCTGAA pLKO.1 968 CDS 100% 4.050 2.430 N Ylpm1 n/a
10 TRCN0000311825 GCCAAGAACAAGACTGCTGAA pLKO_005 968 CDS 100% 4.050 2.430 N Ylpm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178363.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.