Transcript: Mouse NM_178379.3

Mus musculus cytochrome c oxidase assembly protein 10 (Cox10), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cox10 (70383)
Length:
2921
CDS:
95..1426

Additional Resources:

NCBI RefSeq record:
NM_178379.3
NBCI Gene record:
Cox10 (70383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178379.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076734 CGTTCGACTCAAACATGAATA pLKO.1 729 CDS 100% 13.200 18.480 N Cox10 n/a
2 TRCN0000076735 CCGTTCGACTCAAACATGAAT pLKO.1 728 CDS 100% 5.625 7.875 N Cox10 n/a
3 TRCN0000076736 CTTTCCTTGAACACACGTCTT pLKO.1 339 CDS 100% 4.050 5.670 N Cox10 n/a
4 TRCN0000222690 GATCCTGTACTCCTGGCAATT pLKO.1 1039 CDS 100% 10.800 7.560 N Cox10 n/a
5 TRCN0000034555 GCCAACTCCATCAATCAGTTT pLKO.1 698 CDS 100% 4.950 3.465 N COX10 n/a
6 TRCN0000076733 GCAAAGAGAGTTGGATGGTGT pLKO.1 1527 3UTR 100% 2.640 1.848 N Cox10 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1801 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178379.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.