Transcript: Mouse NM_178381.3

Mus musculus anoctamin 9 (Ano9), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ano9 (71345)
Length:
3012
CDS:
88..2331

Additional Resources:

NCBI RefSeq record:
NM_178381.3
NBCI Gene record:
Ano9 (71345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425833 GCCCGTTGTTGGCCCATAAAT pLKO_005 1547 CDS 100% 15.000 21.000 N Ano9 n/a
2 TRCN0000217764 CTACCACAAGAATCCGAATTG pLKO.1 422 CDS 100% 10.800 15.120 N Ano9 n/a
3 TRCN0000446455 GATGATCCAGTACGGCTTTAC pLKO_005 1692 CDS 100% 10.800 15.120 N Ano9 n/a
4 TRCN0000421982 TGAATGACCCTAGTACCTATA pLKO_005 2716 3UTR 100% 10.800 15.120 N Ano9 n/a
5 TRCN0000416220 ATTGCCAATGGAATGGTTATC pLKO_005 1891 CDS 100% 10.800 8.640 N Ano9 n/a
6 TRCN0000177265 GATCTGTTTAATGATTGGCAT pLKO.1 1092 CDS 100% 2.640 2.112 N Ano9 n/a
7 TRCN0000425209 CCATGTATATTTAGGGTATTT pLKO_005 2615 3UTR 100% 13.200 9.240 N Ano9 n/a
8 TRCN0000217399 GAATGACCCTAGTACCTATAG pLKO.1 2717 3UTR 100% 10.800 7.560 N Ano9 n/a
9 TRCN0000181924 CGTGCTATTTGCCATCTTCAT pLKO.1 873 CDS 100% 4.950 3.465 N Ano9 n/a
10 TRCN0000181887 GATATCTTCATGTGCCCTCTT pLKO.1 769 CDS 100% 4.050 2.835 N Ano9 n/a
11 TRCN0000181406 CAAAGAGATCTGTAGTGCCAA pLKO.1 747 CDS 100% 2.640 1.848 N Ano9 n/a
12 TRCN0000200123 CAGCCAGATCAGCAAAGAGAT pLKO.1 735 CDS 100% 4.950 2.970 N Ano9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.