Transcript: Mouse NM_178404.3

Mus musculus zinc finger CCCH type containing 6 (Zc3h6), mRNA.

Source:
NCBI, updated 2019-02-18
Taxon:
Mus musculus (mouse)
Gene:
Zc3h6 (78751)
Length:
4916
CDS:
404..3937

Additional Resources:

NCBI RefSeq record:
NM_178404.3
NBCI Gene record:
Zc3h6 (78751)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430668 GTTATGACTCAGGAGTTTATT pLKO_005 1172 CDS 100% 15.000 21.000 N Zc3h6 n/a
2 TRCN0000086312 CCTAGGGATAAAGGTTCGTTA pLKO.1 3533 CDS 100% 4.950 6.930 N Zc3h6 n/a
3 TRCN0000086311 GCAGAGTTTGACTTACGTCAT pLKO.1 2795 CDS 100% 4.050 5.670 N Zc3h6 n/a
4 TRCN0000431040 ATGACAACTTTGGTAACTATA pLKO_005 861 CDS 100% 13.200 9.240 N Zc3h6 n/a
5 TRCN0000086310 GCGGATGAAGAACTTGTAAAT pLKO.1 1493 CDS 100% 13.200 9.240 N Zc3h6 n/a
6 TRCN0000416934 ACTGATCCAAGACTCGCTAAA pLKO_005 2609 CDS 100% 10.800 7.560 N Zc3h6 n/a
7 TRCN0000424961 GACTTACTTCCAGTACCTTTA pLKO_005 3035 CDS 100% 10.800 7.560 N Zc3h6 n/a
8 TRCN0000086308 CCAGTTGTCTTTCTTAATCAT pLKO.1 4224 3UTR 100% 5.625 3.938 N Zc3h6 n/a
9 TRCN0000086309 CCTTCTTAATACCTTTGGATT pLKO.1 2895 CDS 100% 4.950 3.465 N Zc3h6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.