Transcript: Mouse NM_178418.4

Mus musculus coiled-coil domain containing 144B (Ccdc144b), mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Ccdc144b (241943)
Length:
2506
CDS:
138..1700

Additional Resources:

NCBI RefSeq record:
NM_178418.4
NBCI Gene record:
Ccdc144b (241943)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104003 CCACTTGTCCTAGAGACAGTA pLKO.1 1540 CDS 100% 4.950 3.465 N Ccdc144b n/a
2 TRCN0000104004 CAGTATAAATGGGAAATCGAA pLKO.1 1143 CDS 100% 3.000 2.100 N Ccdc144b n/a
3 TRCN0000104001 GCAGCGTATGAAGACAAGCTA pLKO.1 1227 CDS 100% 3.000 2.100 N Ccdc144b n/a
4 TRCN0000104002 CCAGAATGCAATTCATTCATA pLKO.1 281 CDS 100% 0.563 0.394 N Ccdc144b n/a
5 TRCN0000104000 CCTGAGAACAGCTTGACCATA pLKO.1 2173 3UTR 100% 4.950 2.970 N Ccdc144b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.