Transcript: Human NM_178468.6

Homo sapiens family with sequence similarity 83 member C (FAM83C), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FAM83C (128876)
Length:
3169
CDS:
122..2365

Additional Resources:

NCBI RefSeq record:
NM_178468.6
NBCI Gene record:
FAM83C (128876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178468.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164724 CTGGACCTCATCACCAAGTAT pLKO.1 2159 CDS 100% 5.625 3.938 N FAM83C n/a
2 TRCN0000165615 GCTGGACCTCATCACAAAGTT pLKO.1 2023 CDS 100% 5.625 3.938 N FAM83C n/a
3 TRCN0000166406 CCTGGAGATGTGCTACAAGAT pLKO.1 757 CDS 100% 4.950 3.465 N FAM83C n/a
4 TRCN0000161191 GATGGACATATTCACTGACAT pLKO.1 649 CDS 100% 4.950 3.465 N FAM83C n/a
5 TRCN0000165616 GATGTGCTACAAGATGGACCT pLKO.1 763 CDS 100% 2.160 1.512 N FAM83C n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2515 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178468.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.