Transcript: Human NM_178507.4

Homo sapiens out at first homolog (OAF), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
OAF (220323)
Length:
2262
CDS:
249..1070

Additional Resources:

NCBI RefSeq record:
NM_178507.4
NBCI Gene record:
OAF (220323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178507.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432083 GTTGAACTCCTTGAACGTTTA pLKO_005 1401 3UTR 100% 10.800 15.120 N OAF n/a
2 TRCN0000433859 ATGATGGCCTCTGGTTGTTCT pLKO_005 1380 3UTR 100% 4.950 3.465 N OAF n/a
3 TRCN0000116028 GCACATGGATGTCGCTGTCAA pLKO.1 668 CDS 100% 4.950 3.465 N OAF n/a
4 TRCN0000116030 TGGAGCAAGGTGTGGACAGTT pLKO.1 787 CDS 100% 4.950 3.465 N OAF n/a
5 TRCN0000116029 CGCCGACTTCAAGAAGGATGT pLKO.1 464 CDS 100% 4.050 2.835 N OAF n/a
6 TRCN0000432639 GCTACAGCTTCGACTTCTACG pLKO_005 1000 CDS 100% 4.050 2.835 N OAF n/a
7 TRCN0000432105 ATGTCGCTGTCAACTTCAGCC pLKO_005 676 CDS 100% 2.160 1.512 N OAF n/a
8 TRCN0000426717 TGCATGCTCAAGTACTGCCAC pLKO_005 927 CDS 100% 2.160 1.512 N OAF n/a
9 TRCN0000434334 ACCCAGCTGCAGCACAATGAG pLKO_005 558 CDS 100% 1.650 1.155 N OAF n/a
10 TRCN0000420347 CCCATCTCCACAACGTGTGTG pLKO_005 715 CDS 100% 1.350 0.945 N OAF n/a
11 TRCN0000116027 CCCATCTCACATGACTGTGAA pLKO.1 1208 3UTR 100% 0.495 0.347 N OAF n/a
12 TRCN0000116031 CCTACAAGTGTGGCATCCGCA pLKO.1 967 CDS 100% 0.220 0.132 N OAF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178507.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.