Transcript: Mouse NM_178595.3

Mus musculus peptidyl-tRNA hydrolase 1 homolog (Ptrh1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ptrh1 (329384)
Length:
913
CDS:
10..624

Additional Resources:

NCBI RefSeq record:
NM_178595.3
NBCI Gene record:
Ptrh1 (329384)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178595.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249407 GGAGAATTGGACTCGTGACTC pLKO_005 168 CDS 100% 4.050 5.670 N Ptrh1 n/a
2 TRCN0000257860 CTCTAATACCAGTGGATATAT pLKO_005 619 CDS 100% 15.000 10.500 N Ptrh1 n/a
3 TRCN0000234584 TGGAGTCCGTTCCTGCATTAG pLKO_005 405 CDS 100% 10.800 7.560 N PTRH1 n/a
4 TRCN0000257865 TGGAGTCCGTTCCTGCATTAG pLKO_005 405 CDS 100% 10.800 7.560 N Ptrh1 n/a
5 TRCN0000257877 GCCACAGAACTGCAATGACAC pLKO_005 683 3UTR 100% 4.050 2.835 N Ptrh1 n/a
6 TRCN0000249406 GACTGCGGAGGAGATCTATCT pLKO_005 312 CDS 100% 4.950 2.970 N Ptrh1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178595.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.