Transcript: Mouse NM_178609.5

Mus musculus E2F transcription factor 7 (E2f7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Mus musculus (mouse)
Gene:
E2f7 (52679)
Length:
5554
CDS:
242..2956

Additional Resources:

NCBI RefSeq record:
NM_178609.5
NBCI Gene record:
E2f7 (52679)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178609.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421938 GAATGGTCCAAGCGGACAAGT pLKO_005 1771 CDS 100% 4.950 6.930 N E2f7 n/a
2 TRCN0000084664 CGACCTGTCAAAGCAAAGAAT pLKO.1 397 CDS 100% 5.625 4.500 N E2f7 n/a
3 TRCN0000017456 CGGGTGGCTAAGAATCAGTAT pLKO.1 845 CDS 100% 4.950 3.960 N E2F7 n/a
4 TRCN0000084665 CCTCCGACACAGAGAACTTAA pLKO.1 1815 CDS 100% 13.200 9.240 N E2f7 n/a
5 TRCN0000084663 GCACTTATTCTACAGCTTATT pLKO.1 3514 3UTR 100% 13.200 9.240 N E2f7 n/a
6 TRCN0000084666 AGGCTCTATGACATAGCCAAT pLKO.1 1244 CDS 100% 4.050 2.835 N E2f7 n/a
7 TRCN0000084667 AGTTCTCTATTCTCCCGCAAT pLKO.1 2494 CDS 100% 4.050 2.835 N E2f7 n/a
8 TRCN0000417968 CACCCAACTCTTCATGCTGTA pLKO_005 1879 CDS 100% 4.050 2.835 N E2f7 n/a
9 TRCN0000425017 TGTTGCTCAAACAGATTTGCC pLKO_005 1735 CDS 100% 2.640 1.848 N E2f7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178609.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.