Transcript: Mouse NM_178629.6

Mus musculus CDP-L-ribitol pyrophosphorylase A (Crppa), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Mus musculus (mouse)
Gene:
Crppa (75847)
Length:
2818
CDS:
325..1668

Additional Resources:

NCBI RefSeq record:
NM_178629.6
NBCI Gene record:
Crppa (75847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178629.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183573 GTATCAGCAGTGTAGTGATTT pLKO.1 993 CDS 100% 13.200 9.240 N Crppa n/a
2 TRCN0000179513 GCCAGACTGTAAACTCACTAA pLKO.1 741 CDS 100% 4.950 3.465 N Crppa n/a
3 TRCN0000179665 GAGAAGTATCATCCAGAGGTA pLKO.1 633 CDS 100% 2.640 1.848 N Crppa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178629.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.