Transcript: Mouse NM_178635.3

Mus musculus UV radiation resistance associated gene (Uvrag), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Uvrag (78610)
Length:
3438
CDS:
195..2291

Additional Resources:

NCBI RefSeq record:
NM_178635.3
NBCI Gene record:
Uvrag (78610)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121008 CGCAACCAGAATGAAATCATT pLKO.1 636 CDS 100% 5.625 7.875 N Uvrag n/a
2 TRCN0000329518 CGCAACCAGAATGAAATCATT pLKO_005 636 CDS 100% 5.625 7.875 N Uvrag n/a
3 TRCN0000329451 GGCATTTGTCTGCGGTTTATT pLKO_005 2563 3UTR 100% 15.000 12.000 N Uvrag n/a
4 TRCN0000121010 CTGTCCTACATTTACCCTATT pLKO.1 1164 CDS 100% 10.800 8.640 N Uvrag n/a
5 TRCN0000329450 GAATGAGAACAAGGATTATTT pLKO_005 1190 CDS 100% 15.000 10.500 N Uvrag n/a
6 TRCN0000329449 TCTCAGAGCTGTCCTACATTT pLKO_005 1156 CDS 100% 13.200 9.240 N Uvrag n/a
7 TRCN0000329452 ACATCGCTGCTCGGAACATTG pLKO_005 334 CDS 100% 10.800 7.560 N Uvrag n/a
8 TRCN0000121009 CCAGATCAACAATCAAAGATA pLKO.1 1363 CDS 100% 5.625 3.938 N Uvrag n/a
9 TRCN0000121011 CCTACATTTACCCTATTGATT pLKO.1 1168 CDS 100% 5.625 3.938 N Uvrag n/a
10 TRCN0000121007 CCCTAGATATAAATCCTGTTA pLKO.1 3096 3UTR 100% 4.950 3.465 N Uvrag n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.