Transcript: Mouse NM_178641.5

Mus musculus inositol polyphosphate-5-phosphatase F (Inpp5f), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Inpp5f (101490)
Length:
4740
CDS:
231..3629

Additional Resources:

NCBI RefSeq record:
NM_178641.5
NBCI Gene record:
Inpp5f (101490)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178641.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416876 AGAGCAGGAATGCGGTATAAA pLKO_005 1092 CDS 100% 15.000 21.000 N Inpp5f n/a
2 TRCN0000437138 GGGCTAACTCATGGGATAAAC pLKO_005 3492 CDS 100% 13.200 18.480 N Inpp5f n/a
3 TRCN0000080700 GCCAGCTCTTACAGAGTTATA pLKO.1 2029 CDS 100% 13.200 10.560 N Inpp5f n/a
4 TRCN0000052874 GCTCTGTAAGAAGCATCATTT pLKO.1 545 CDS 100% 13.200 10.560 N INPP5F n/a
5 TRCN0000307811 GCTCTGTAAGAAGCATCATTT pLKO_005 545 CDS 100% 13.200 10.560 N INPP5F n/a
6 TRCN0000434505 TAGTGTGCATTAGTATCTAAA pLKO_005 4033 3UTR 100% 13.200 10.560 N Inpp5f n/a
7 TRCN0000080701 CGAGGAATGAAGTTCGAGAAT pLKO.1 1473 CDS 100% 4.950 3.960 N Inpp5f n/a
8 TRCN0000419910 AGTCTGAACCTTAGCAAATTT pLKO_005 3762 3UTR 100% 15.000 10.500 N Inpp5f n/a
9 TRCN0000080699 GCCTACTATGTGGCCTATTAT pLKO.1 2172 CDS 100% 15.000 10.500 N Inpp5f n/a
10 TRCN0000080698 GCAGGAATATAAGATCATGTT pLKO.1 4216 3UTR 100% 4.950 3.465 N Inpp5f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178641.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.