Transcript: Mouse NM_178676.4

Mus musculus ectonucleoside triphosphate diphosphohydrolase 3 (Entpd3), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Entpd3 (215446)
Length:
3467
CDS:
79..1668

Additional Resources:

NCBI RefSeq record:
NM_178676.4
NBCI Gene record:
Entpd3 (215446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178676.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080762 TGGATGGATTACAGCCAACTA pLKO.1 633 CDS 100% 4.950 6.930 N Entpd3 n/a
2 TRCN0000080761 CTGGCATTTCTTCTGTATCTA pLKO.1 1582 CDS 100% 5.625 3.938 N Entpd3 n/a
3 TRCN0000080760 GCTTCTGTGTTTGACTTCAAT pLKO.1 1093 CDS 100% 5.625 3.938 N Entpd3 n/a
4 TRCN0000080758 CCCTAAATACAGAGTCCCTAT pLKO.1 2480 3UTR 100% 4.050 2.835 N Entpd3 n/a
5 TRCN0000080759 GCTCAAATCATTTCTGGGCAA pLKO.1 598 CDS 100% 2.160 1.512 N Entpd3 n/a
6 TRCN0000359354 ATGGATTACAGCCAACTATTT pLKO_005 636 CDS 100% 13.200 9.240 N ENTPD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178676.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.