Transcript: Mouse NM_178697.5

Mus musculus chloride channel accessory 2 (Clca2), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Clca2 (229933)
Length:
4008
CDS:
143..2971

Additional Resources:

NCBI RefSeq record:
NM_178697.5
NBCI Gene record:
Clca2 (229933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178697.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182920 CCAGTGATCATTTATGCGAAT pLKO.1 2003 CDS 100% 4.050 5.670 N Clca2 n/a
2 TRCN0000182944 CCAGGTTACATAACAAACGAT pLKO.1 2279 CDS 100% 3.000 4.200 N Clca2 n/a
3 TRCN0000180987 CCAGAATGCAACTGGATCAAT pLKO.1 841 CDS 100% 5.625 4.500 N Clca2 n/a
4 TRCN0000195809 CCCAGGAAACCATGCTATGTA pLKO.1 2254 CDS 100% 5.625 4.500 N Clca2 n/a
5 TRCN0000216538 GCAAACTACAAGCTATGAAAT pLKO.1 2524 CDS 100% 13.200 9.240 N Clca2 n/a
6 TRCN0000180532 GCCATACTACAGGGTTCTTTA pLKO.1 3441 3UTR 100% 13.200 9.240 N Clca2 n/a
7 TRCN0000196241 GCCCTGGTATCAATGTCTCTT pLKO.1 2783 CDS 100% 4.950 3.465 N Clca2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178697.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.