Transcript: Mouse NM_178736.5

Mus musculus ELMO/CED-12 domain containing 2 (Elmod2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Elmod2 (244548)
Length:
4709
CDS:
144..1025

Additional Resources:

NCBI RefSeq record:
NM_178736.5
NBCI Gene record:
Elmod2 (244548)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178736.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247998 ACTGATCAATCTCGTGTATTT pLKO_005 662 CDS 100% 13.200 18.480 N Elmod2 n/a
2 TRCN0000217747 GACTGATCAATCTCGTGTATT pLKO.1 661 CDS 100% 13.200 18.480 N Elmod2 n/a
3 TRCN0000192930 GCGGACAATCAGTGTATGTTT pLKO.1 1163 3UTR 100% 5.625 7.875 N Elmod2 n/a
4 TRCN0000247996 CAGATTCTCTCCCGCTCAAAT pLKO_005 711 CDS 100% 13.200 10.560 N Elmod2 n/a
5 TRCN0000192419 CAGGTGTATAGCGAACATCAT pLKO.1 356 CDS 100% 4.950 3.960 N Elmod2 n/a
6 TRCN0000129933 GATGGCTTATAGCTTACTGAA pLKO.1 782 CDS 100% 4.950 3.960 N ELMOD2 n/a
7 TRCN0000248000 TCTGGTGTTTCTGGGTAATAT pLKO_005 1948 3UTR 100% 15.000 10.500 N Elmod2 n/a
8 TRCN0000247997 TGCAGATAACTGGCTATAAAC pLKO_005 442 CDS 100% 13.200 9.240 N Elmod2 n/a
9 TRCN0000247999 AGTTTCACGAGCGGATCAAAG pLKO_005 961 CDS 100% 10.800 7.560 N Elmod2 n/a
10 TRCN0000422559 TTAGGGTATTCTTATGCAATA pLKO_005 741 CDS 100% 10.800 7.560 N ELMOD2 n/a
11 TRCN0000200687 GCTGTGTTAGTCTTTAACTTT pLKO.1 2755 3UTR 100% 5.625 3.938 N Elmod2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178736.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.