Transcript: Mouse NM_178768.4

Mus musculus transmembrane protein 72 (Tmem72), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tmem72 (319776)
Length:
3335
CDS:
182..1009

Additional Resources:

NCBI RefSeq record:
NM_178768.4
NBCI Gene record:
Tmem72 (319776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178768.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257828 CTACGGCTGCAGTGTTGATTG pLKO_005 240 CDS 100% 10.800 15.120 N Tmem72 n/a
2 TRCN0000177080 GCAAACCTATACTTTCCATGA pLKO.1 679 CDS 100% 4.050 5.670 N Tmem72 n/a
3 TRCN0000248918 CATTCCAGGCTCCATGTTAAT pLKO_005 523 CDS 100% 13.200 9.240 N Tmem72 n/a
4 TRCN0000257820 GACCTCCAGCAAGGTACAAAT pLKO_005 1172 3UTR 100% 13.200 9.240 N Tmem72 n/a
5 TRCN0000181873 GCAGACCCAAGATACCCTAAT pLKO.1 778 CDS 100% 10.800 7.560 N Tmem72 n/a
6 TRCN0000248919 GCAGACCCAAGATACCCTAAT pLKO_005 778 CDS 100% 10.800 7.560 N Tmem72 n/a
7 TRCN0000248917 TGTGTGAAGGGACCTACTTTG pLKO_005 342 CDS 100% 10.800 7.560 N Tmem72 n/a
8 TRCN0000178181 GATAGTGACAGTGAACCAGAA pLKO.1 902 CDS 100% 4.050 2.430 N Tmem72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178768.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.