Transcript: Mouse NM_178931.2

Mus musculus tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) (Tnfrsf14), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Tnfrsf14 (230979)
Length:
893
CDS:
32..859

Additional Resources:

NCBI RefSeq record:
NM_178931.2
NBCI Gene record:
Tnfrsf14 (230979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065855 TGGTGCCTTGTGTCTTCCTTT pLKO.1 99 CDS 100% 4.950 6.930 N Tnfrsf14 n/a
2 TRCN0000065853 CGTCTACTACGTTGTGTCCAT pLKO.1 652 CDS 100% 2.640 3.696 N Tnfrsf14 n/a
3 TRCN0000065854 CAACCCAGGTTACCATGTGAA pLKO.1 202 CDS 100% 4.950 3.465 N Tnfrsf14 n/a
4 TRCN0000065857 GCATTTCAACAGGAAGTAAGA pLKO.1 590 CDS 100% 4.950 3.465 N Tnfrsf14 n/a
5 TRCN0000065856 CCACAGACATATACCGCCCAT pLKO.1 269 CDS 100% 2.160 1.512 N Tnfrsf14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.