Transcript: Mouse NM_178936.3

Mus musculus transmembrane protein 56 (Tmem56), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem56 (99887)
Length:
6224
CDS:
250..1080

Additional Resources:

NCBI RefSeq record:
NM_178936.3
NBCI Gene record:
Tmem56 (99887)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178936.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422600 GAAAGTGATCGGCGACAAATT pLKO_005 618 CDS 100% 13.200 18.480 N Tmem56 n/a
2 TRCN0000173426 GATCATTTCGATACCTCCGAT pLKO.1 852 CDS 100% 2.640 3.696 N Tmem56 n/a
3 TRCN0000415968 CAAGAGTTTCTTCAGGTTATA pLKO_005 383 CDS 100% 13.200 9.240 N Tmem56 n/a
4 TRCN0000174444 CCAATAAGTATGTTCGGAATA pLKO.1 2983 3UTR 100% 10.800 7.560 N Tmem56 n/a
5 TRCN0000176212 GCTTAGTTTGTCTTTGCCTTT pLKO.1 2015 3UTR 100% 4.050 2.835 N Tmem56 n/a
6 TRCN0000141056 CATCAGACAAGAGAAAGCCAA pLKO.1 1029 CDS 100% 2.640 1.848 N TLCD4 n/a
7 TRCN0000173188 CCACTCTTTGTTAGTTGGGAT pLKO.1 459 CDS 100% 2.640 1.848 N Tmem56 n/a
8 TRCN0000175032 GATGAATATCATGTGGATGAT pLKO.1 972 CDS 100% 0.495 0.347 N Tmem56 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178936.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.