Transcript: Mouse NM_180958.3

Mus musculus telomere repeat binding bouquet formation protein 1 (Terb1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Terb1 (320022)
Length:
2950
CDS:
220..2526

Additional Resources:

NCBI RefSeq record:
NM_180958.3
NBCI Gene record:
Terb1 (320022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_180958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113326 CCTGAGGTAATTCGACCTATA pLKO.1 868 CDS 100% 10.800 15.120 N Terb1 n/a
2 TRCN0000113328 GCAGGTATTTATTTCCGGGAA pLKO.1 367 CDS 100% 2.160 3.024 N Terb1 n/a
3 TRCN0000113325 CGGTCCTTTGTTTGGACTCTT pLKO.1 2539 3UTR 100% 4.950 3.960 N Terb1 n/a
4 TRCN0000113327 CCTGTAGAAGAAGACAACTTT pLKO.1 2165 CDS 100% 5.625 3.938 N Terb1 n/a
5 TRCN0000113329 CCATTGATGATACAAGCCTTA pLKO.1 1249 CDS 100% 4.050 2.835 N Terb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_180958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.