Transcript: Mouse NM_181040.4

Mus musculus ATP synthase mitochondrial F1 complex assembly factor 1 (Atpaf1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Atpaf1 (230649)
Length:
2330
CDS:
166..1212

Additional Resources:

NCBI RefSeq record:
NM_181040.4
NBCI Gene record:
Atpaf1 (230649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181040.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076190 CGCAGTTATTCCTAAAGAGAA pLKO.1 753 CDS 100% 4.950 3.960 N Atpaf1 n/a
2 TRCN0000076188 CCCACTTCTATGACTTCATAA pLKO.1 1599 3UTR 100% 13.200 9.240 N Atpaf1 n/a
3 TRCN0000076189 GCTCCACTTCACTGCACTTAT pLKO.1 879 CDS 100% 13.200 9.240 N Atpaf1 n/a
4 TRCN0000076192 CCCAGAACCAAGATAAGACTT pLKO.1 1190 CDS 100% 4.950 3.465 N Atpaf1 n/a
5 TRCN0000076191 GCAGAAATGGACTCCACATTT pLKO.1 994 CDS 100% 1.320 0.924 N Atpaf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181040.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.