Transcript: Human NM_181337.4

Homo sapiens kidney associated antigen 1 (KAAG1), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
KAAG1 (353219)
Length:
1383
CDS:
738..992

Additional Resources:

NCBI RefSeq record:
NM_181337.4
NBCI Gene record:
KAAG1 (353219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181337.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438173 ACCTGCTACGGGCAGAATCAA pLKO_005 1123 3UTR 100% 5.625 7.875 N KAAG1 n/a
2 TRCN0000438217 ACTCGGAGTAGACGCTCAAGT pLKO_005 1043 3UTR 100% 4.950 6.930 N KAAG1 n/a
3 TRCN0000166751 CCTGAAACGAACGAGAAACTG pLKO.1 945 CDS 100% 4.950 6.930 N KAAG1 n/a
4 TRCN0000165124 CTGACGAATCCACAGGTGAAA pLKO.1 963 CDS 100% 4.950 3.960 N KAAG1 n/a
5 TRCN0000163589 GAATCCACAGGTGAAAGAGAA pLKO.1 968 CDS 100% 4.950 3.465 N KAAG1 n/a
6 TRCN0000443919 GTACACAAGCACGCTCTTCAC pLKO_005 783 CDS 100% 4.050 2.835 N KAAG1 n/a
7 TRCN0000166428 CGAGAAACTGACGAATCCACA pLKO.1 956 CDS 100% 2.640 1.848 N KAAG1 n/a
8 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 1231 3UTR 100% 15.000 7.500 Y KAAG1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1227 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181337.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.