Transcript: Mouse NM_181344.5

Mus musculus complement component 1, r subcomponent-like (C1rl), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
C1rl (232371)
Length:
3010
CDS:
39..1487

Additional Resources:

NCBI RefSeq record:
NM_181344.5
NBCI Gene record:
C1rl (232371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181344.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031407 GCGACTCTGTCACAATTTCAA pLKO.1 334 CDS 100% 5.625 4.500 N C1rl n/a
2 TRCN0000031405 CACTGCCAAGATCCTTATTAT pLKO.1 603 CDS 100% 15.000 10.500 N C1rl n/a
3 TRCN0000031404 CCACAACTTCAATGGAGATAT pLKO.1 1022 CDS 100% 13.200 9.240 N C1rl n/a
4 TRCN0000031406 CTACTGAAACTCGGGAACCAT pLKO.1 954 CDS 100% 3.000 2.100 N C1rl n/a
5 TRCN0000031408 CCCTGGATACCCAGAGCCATA pLKO.1 209 CDS 100% 1.350 0.810 N C1rl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181344.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.