Transcript: Mouse NM_181397.2

Mus musculus raftlin lipid raft linker 1 (Rftn1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rftn1 (76438)
Length:
2802
CDS:
290..1954

Additional Resources:

NCBI RefSeq record:
NM_181397.2
NBCI Gene record:
Rftn1 (76438)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198125 CAACGCCTATACTCAAGACTA pLKO.1 1521 CDS 100% 4.950 6.930 N Rftn1 n/a
2 TRCN0000178256 GCCTGTCTTAAGGTAGTTCTA pLKO.1 2463 3UTR 100% 4.950 6.930 N Rftn1 n/a
3 TRCN0000177932 CCACTGGAAAGCTGTCTTAAT pLKO.1 2109 3UTR 100% 13.200 9.240 N Rftn1 n/a
4 TRCN0000176918 GCAAGAACATAGTGACATTAA pLKO.1 2343 3UTR 100% 13.200 9.240 N Rftn1 n/a
5 TRCN0000216775 GCAAATTGAGTCCGTGGTTTA pLKO.1 1946 CDS 100% 10.800 7.560 N Rftn1 n/a
6 TRCN0000182839 CCTGTTGCCAACAGTGTTGAA pLKO.1 824 CDS 100% 4.950 3.465 N Rftn1 n/a
7 TRCN0000182522 CCTAGAAGGTACAGAGGTACA pLKO.1 1435 CDS 100% 4.050 2.835 N Rftn1 n/a
8 TRCN0000177755 CCCAGAGTTCATTAAGAAGGT pLKO.1 712 CDS 100% 2.640 1.848 N Rftn1 n/a
9 TRCN0000215938 CAGATGGAGTATTCATCTTTG pLKO.1 1344 CDS 100% 1.080 0.756 N Rftn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.