Transcript: Human NM_181501.2

Homo sapiens integrin subunit alpha 1 (ITGA1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ITGA1 (3672)
Length:
10736
CDS:
439..3978

Additional Resources:

NCBI RefSeq record:
NM_181501.2
NBCI Gene record:
ITGA1 (3672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057750 CCCTCGAAACACAACCTTTAA pLKO.1 1683 CDS 100% 13.200 18.480 N ITGA1 n/a
2 TRCN0000057749 CCCACATTTCAAGTCGTGAAT pLKO.1 895 CDS 100% 4.950 6.930 N ITGA1 n/a
3 TRCN0000057748 CCCTAGATTCACTAAGACAAA pLKO.1 2612 CDS 100% 4.950 6.930 N ITGA1 n/a
4 TRCN0000434474 TCTGGAGATGTGCTCTATATT pLKO_005 1777 CDS 100% 15.000 12.000 N ITGA1 n/a
5 TRCN0000432608 GACAGTCAGCACTCGTAAATG pLKO_005 4391 3UTR 100% 13.200 9.240 N ITGA1 n/a
6 TRCN0000057752 CCTTCTTGAAAGAATGGATAT pLKO.1 1023 CDS 100% 10.800 6.480 N ITGA1 n/a
7 TRCN0000057751 GCTCTCAATCAGACAAGGTTT pLKO.1 2026 CDS 100% 4.950 2.970 N ITGA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.