Transcript: Human NM_181534.4

Homo sapiens keratin 25 (KRT25), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KRT25 (147183)
Length:
1669
CDS:
61..1413

Additional Resources:

NCBI RefSeq record:
NM_181534.4
NBCI Gene record:
KRT25 (147183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181534.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424209 AGACCTACTGTCTCCTTATAG pLKO_005 1202 CDS 100% 13.200 9.240 N KRT25 n/a
2 TRCN0000116493 CCAGCTTTGGTACTGGAAATT pLKO.1 143 CDS 100% 13.200 9.240 N KRT25 n/a
3 TRCN0000423268 CAGATCTGGAGATTCAGTATG pLKO_005 662 CDS 100% 10.800 7.560 N KRT25 n/a
4 TRCN0000420550 CTGGATCACTCAGACTCTATG pLKO_005 113 CDS 100% 10.800 7.560 N KRT25 n/a
5 TRCN0000428471 GTGTAGAGGCTGATGTCAATG pLKO_005 602 CDS 100% 10.800 7.560 N KRT25 n/a
6 TRCN0000116495 CCAGGCTTACAGCTGATGATT pLKO.1 542 CDS 100% 5.625 3.938 N KRT25 n/a
7 TRCN0000116496 CCCGGAATGAGCTGACTGAAA pLKO.1 944 CDS 100% 4.950 3.465 N KRT25 n/a
8 TRCN0000116492 GCATTATGTATCTGTCCAGAA pLKO.1 1463 3UTR 100% 4.050 2.835 N KRT25 n/a
9 TRCN0000116494 GCCATAGTGGTTAAGAAAGTT pLKO.1 1315 CDS 100% 5.625 3.375 N KRT25 n/a
10 TRCN0000420666 TGACCATGCAGAACCTCAATG pLKO_005 302 CDS 100% 10.800 5.400 Y KRT16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181534.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.